Login    Mobile
Hint Food 맛과향 Diet Health 불량지식 사 례 바로보기 위 로 자연과학 원 료 제 품 Update Site

내몸감각  ≫ 후각 , Flavor

G protein - 후각기관   

감각 기관
- 미각 메커니즘 : 수용체, 경로
- 후각 메커니즘 : 수용체, 경로
- 시각 메커니즘 : 수용체, 경로
- OFC 감각연합 : G protein

후각기관 :  후각 메커니즘, 경로
- 후각세포 : GPCR
- 작은 통합 glomerulus
- 후각 수용체 종류













 

 




 

 

 


'냄새 잘 맡는 쥐'가 지뢰와 질병을 탐지한다
생명과학  양병찬 (2016-07-08 09:21)

마우스는 냄새 수용체와 (냄새의 화학적 표지에 반응하는) 세포센서에 할당된 유전자를 약 1,200개 보유하고 있는데, 이는 랫트보다 수백 개 적으며, 개와 비슷한 수준이다. 이에 비해 인간의 후각유전자는 겨우 350개밖에 안 되니, 그야말로 '쥐꼬리만 한' 수준이다. / © Pixabay.com

의사와 군인들은 언젠가 뜻밖의 동맹군을 신뢰하게 될 것 같다. 그것은 바로 쥐다. 과학자들은 쥐의 유전자를 조작하여 특정한 냄새에 극도로 민감하게 만듦으로써, 동물을 이용하여 지뢰나 질병(파킨슨병, 알츠하이머병)의 화학적 표지를 찾아내는 길을 열었다.

훈련받은 랫트나 개는 오랫동안 지뢰 속에 포함된 TNT의 냄새를 탐지하는 데 사용되어 왔다. 과학자들은 "개가 저혈당이나 특정 암(癌)의 화학적 신호를 추적할 수 있다"고 제안하고 있다. 마우스의 후각 또한 예민하여, 냄새 수용체와 (냄새의 화학적 표지에 반응하는) 세포센서에 할당된 유전자를 약 1,200개 보유하고 있는데, 이는 랫트보다 수백 개 적으며, 개와 비슷한 수준이다. 이에 비해 인간의 후각유전자는 겨우 350개밖에 안 되니, 그야말로 '쥐꼬리만한' 수준이다.

미국 헌터 칼리지의 폴 파인스타인 박사(신경과학)는 그렇잖아도 민감한 쥐의 코를 업그레이드하는 데 관심을 갖고 있다. 그는 지난 10년 동안 '후각 시스템 내부의 뉴런 표면에서 후각 수용체가 어떻게 형성되는지'를 연구해 왔다. 배아발생 과정에서, 각각의 후각뉴런은 하나의 후각수용체를 발현하도록 전문화되는데, 후각수용체는 공기 중의 화학물질과 결합하여 특정한 냄새를 탐지하게 된다. 그런데 후각수용체는 후각시스템 전체에 균일하게 분포되어 있으며, 각각의 수용체가 쥐의 뉴런에서 차지하는 비율은 약 0.1%다.

파인스타인 박사는 이런 의문을 품게 되었다. "특정 후각수용체의 수를 선택적으로 늘림으로써, 쥐의 코가 특정 냄새에 좀 더 민감하게 만들 수는 없을까?" 그가 이끄는 연구진은 DNA 시퀀스(21-bp gene choice enhancer: ACATAACTTTTTAATGAGTCT)를 개발하여 쥐의 수정란 속의 핵에 주입했는데, 그 결과 후각뉴런이 특정 후각수용체를 많이 발현하는 것으로 나타났다. 문제의 수용체는 M71로, 자스민 비슷한 냄새가 나는 아세토페논(acetophenone)이라는 화학물질을 탐지한다. 연구진이 4개 이상의 DNA 시퀀스를 쥐의 난자에 주입해 보니, 총 1%의 뉴런이 M71을 보유하는 것으로 나타났는데, 이는 일반적인 수준(0.1%)의 열 배에 해당된다.

한편 파인스타인 박사의 연구실에서 박사후 과정을 밟고 있는 샬롯 뒬스트는 인간의 후각유전자를 쥐의 유전체에 삽입하려고 노력했지만 번번이 실패했다. 모종의 이유 때문에, 시행착오를 거쳐 유전자를 삽입하는 방법은 성공할 수 없었다. 그래서 그녀는 파인스타인과 손을 잡고, 그가 개발한 기술을 이용하여 인간의 후각수용체(OR1A1)를 쥐에게 도입하는 데 성공했다. OR1A1은 박하 비슷한 냄새가 나는 화학물질을 탐지하는 수용체다.

OR1A1는 잘 작동했으며, 쥐의 후각뉴런에서 차지하는 비율이 무려 13%인 것으로 나타났다. "파인스타인 박사가 개발한 DNA 시퀀스의 정확한 작용 메커니즘은 아직 알 수 없지만, 우리는 후각수용체의 비율을 선별적으로 바꾸는 데  성공했다"라고 뒬스트는 말했다.

수용체의 변화가 쥐의 후각을 어떻게 변화시키는지 알아보기 위해, 연구진은 'GM 쥐'와 '일반 쥐'에게 두 개의 물병을 줬는데, 그중 하나는 미량의 화학물질(M71이나 OR1A1을 자극하는 화학물질)을 포함하고 있으며, 다른 하나는 맹물이다. 연구진이 화학물질의 농도를 계속 낮춰가며 실험해본 결과, M71을 많이 보유한 쥐는 2배, OR1A1을  많이 보유한 쥐는 100배나 후각이 예민해진 것으로 밝혀졌다. 파인스타인의 예측에 의하면, 자신이 개발한 DNA 시퀀스를 좀 더 다듬을 경우 쥐의 후각을 훨씬 더 예민하게 만들 수 있다고 한다. 연구진은 이상의 연구결과를 정리하여, 7월 7일 《Cell Reports》에 기고했다.

파인스타인 박사는 이번에 사용된 기술이 인간 후각시스템의 블랙박스를 해독하는 데 도움이 될 거라고 생각하고 있다. "현재 인간의 뇌가 냄새를 처리하는 과정은 별로 알려지지 않았다. 만약 쥐의 유전자를 조작하여 인간의 모든 후각수용체를 선별적으로 보유하도록 만들 수 있다면, 어떤 화학물질이 어떤 수용체를 자극하는지를 알 수 있을 것이다. 우리의 궁극적인 목표는 후각시스템의 코드를 해독하는 것이다"라고 그는 말했다.

이번 연구는 다양한 분야에 응용될 수 있을 것으로 보인다. 예컨대 엔지니어들은 노즈온어칩(nose-on-a-chip)을 만들어, 향수 제조업자들로 하여금 향수를 정확히 설계할 수 있도록 해줄 수 있을 것이다. 파인스타인 박사에 의하면, 극미량의 TNT를 탐지함으로써 지뢰를 찾아내는 쥐를 만들 수도 있는데, 그럴 경우 아무리 은폐되거나 위장된 위험물질도 탐지할 수 있을 거라고 한다. 나아가 질병이 보유한 미량의 화학표지를 탐지함으로써, 질병을 찾아내는 것도 가능할 것으로 보인다. "우리가 탐지할 수 있는 것은 냄새에만 국한되지 않는다. 파킨슨병이든 알츠하이머병이든 결핵이든, 체액의 화학적 조성을 바꿔 흔적을 남기는 거라면 뭐든 탐지할 수 있다"라고 파인스타인 박사는 말했다.



페이스북       방명록      수정 2016-07-09 / 등록 2011-12-29 / 조회 : 12513 (121)



우리의 건강을 해치는 불량지식이 없는 아름다운 세상을 꿈꾸며 ...  2009.12  최낙언